negative control sequence without 5’ overhangs (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
negative control sequence without 5’ overhangs
![KEY RESOURCES TABLE]()
Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence+without+5%E2%80%99+overhangs/negative+control+sequence+without+5%E2%80%99+overhangs/pmc12210276-48-0-8
Average 90 stars, based on 1 article reviews
Negative Control Sequence Without 5’ Overhangs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+sequence+without+5%E2%80%99+overhangs/negative+control+sequence+without+5%E2%80%99+overhangs/pmc12210276-48-0-8
Average 90 stars, based on 1 article reviews
negative control sequence without 5’ overhangs - by Bioz Stars,
2026-10
90/100 stars
Images
1) Product Images from "Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility"
Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility
Journal: Neuron
doi: 10.1016/j.neuron.2025.05.023
Figure Legend Snippet: KEY RESOURCES TABLE
Techniques Used: Virus, Generated, Cloning, Expressing, Recombinant, Blocking Assay, Plasmid Preparation, Negative Control, Sequencing, Software
Related Articles
Negative Control:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Sequencing:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Virus:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Generated:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Cloning:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Expressing:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Recombinant:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Blocking Assay:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Plasmid Preparation:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , Software:Article Title: Major Depressive Disorder associated dysregulation of ZBTB7A in orbitofrontal cortex promotes astrocyte-mediated stress susceptibility Article Snippet: Negative control sequence without 5’ overhangs: GAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT , |